EstMap Program Description

Program for mapping a whole set of mRNAs/ESTs to a chromosome sequence. For example, 11,000 sequences of full mRNAs from NCBI reference set were mapped to 52-MB unmasked Y chromosome fragment in about 18-25 min, depending on computer memory size. EstMap takes into account statistical features of splice sites for more accurate mapping.

EstMap is part of FGENESH++C genome annotation pipeline, where it maps RefSeq sequences to a query genome at very early stages of annotation.

Example of an output of the EstMap program:

L:49476872   Sequence chr22 vs. 2 Base sequences [/home/apache/tmp/RrdFeT.rnamap].
[DD] Sequence:       1(      1), S:      26.989, L:      360 
AA704607   zj19g11.s1 Soares_fetal_liver_spleen_1NFLS_S1 Homo sapiens cDNA clone

        1 nnnnnnnnnnnnnnn(..)ttttttttttttttt?[GAAGGTTTCAAATATACTTTATTT
          ...............(..)...............  |||||||||||||0||||||||||
        1 ---------------(..)---------------  GAAGGTTTCAAATGTACTTTATTT

 33914973 CTTCAATAAT]gtcatatcttttttt(..)ccacgcccggctaat[TCTTAATGGGCACA
          |||||||||| ...............(..)............... ||||||||||0|||
       25 CTTCAATAAT gcc------------(..)------------ata TCTTAATGGGTACA

 33915177 CAGTGCTTTCACTTGGCATCAATCATGAGCTGTTTTTTAAACAATTCGGTATTACACCAG
          |||||||||0|0|||||||||||0|||||||||||||||||||||||00|||||||||||
       55 CAGTGCTTTAATTTGGCATCAATTATGAGCTGTTTTTTAAACAATTCATTATTACACCAG

 33915237 CTGGAATGATCACTGATctatccgTCCT-------TTTGGGGTGGCTCAGCTAACAGGGG
          ||||0|||||0||||||.......||||.......||||||||00|||0||0||||||||
      115 CTGGGATGATTACTGAT-------TCCTccattccTTTGGGGTAACTCTGCCAACAGGGG

 33915290 ATGGGTTCCATTCCATTTCGATTTGTGTTGCTACACTTGTCCATACAGCAGTACAGAAAG
          |00||||||||||0|||0|||0|||||||||||||00|||||||00|0||0|||||||||
      168 ACAGGTTCCATTCTATTCCGACTTGTGTTGCTACATATGTCCATGTAACAATACAGAAAG

 33915350 TGGCTCCACTAGCTAATACAGCATTACCATATCTGTCATGAAAATCAGGTGTACCTTTCT
          ||||||||||||||||||||||||||||0|||0|||||||||||||||||||||0|||||
      228 TGGCTCCACTAGCTAATACAGCATTACCGTATTTGTCATGAAAATCAGGTGTACGTTTCT

 33915410 GGTGGCTCTGCCTTGCCATTGTTTGCTGAATGCTTCGAACTTGGAGACGA]?cttgagtg
          |||||||||||00|||||||||||||||||||||||||||||||||||||  ........
      288 GGTGGCTCTGCTCTGCCATTGTTTGCTGAATGCTTCGAACTTGGAGACGA  tttagtgc

 33915468 tgttttt(..)nnnnnnnnnnnnnnn
          .......(..)...............
      346 gcttttg(..)---------------